Review



primer select program of dnastar 7.01 software  (DNASTAR)


Bioz Verified Symbol DNASTAR is a verified supplier
Bioz Manufacturer Symbol DNASTAR manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    DNASTAR primer select program of dnastar 7.01 software
    Primer Select Program Of Dnastar 7.01 Software, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnastar+primer+select+program/primer+select+program+of+dnastar+7+01+software/pm37179263-48-47-47
    Average 90 stars, based on 1 article reviews
    primer select program of dnastar 7.01 software - by Bioz Stars, 2026-11
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: Phytophthora infestans Cholinephosphotransferase with Substrate Specificity for Very-Long-Chain Polyunsaturated Fatty Acids
    Article Snippet: Gene specific primers (Forward: 5’CGCGGATCCataATGCTGGGGAAGAAG3’; 128 Reverse: 5’CCGCTCGAGCTACTTCGCCTTTTCAG3’), designed based on the genome 129 sequences using DNAstar-Primer Select program, were used to retrieve the full-length cDNAs 130 7 using reverse transcriptase-PCR (Invitrogen Canada Inc., Burlington, Ontario).

    Synthesized:

    Article Title: Changes of Bax, Bcl-2 and apoptosis in hippocampus in the rat model of post-traumatic stress disorder
    Article Snippet: Objective: Post-traumatic stress disorder (PTSD) is a stress-related mental disorder caused by experience of a traumatic event.. PTSD is often accompanied by morphological and functional changes in the hippocampus.. Recently, it was reported that the hippocampal volumes of PTSD patients are relatively low.



    Similar Products

    primer select program of dnastar 7.01 software  (DNASTAR)
    90
    DNASTAR primer select program of dnastar 7.01 software
    Primer Select Program Of Dnastar 7.01 Software, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnastar+primer+select+program/primer+select+program+of+dnastar+7+01+software/pm37179263-48-47-47
    Average 90 stars, based on 1 article reviews
    primer select program of dnastar 7.01 software - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    primer select program dnastar 5.0 software  (DNASTAR)
    90
    DNASTAR primer select program dnastar 5.0 software
    Primer Select Program Dnastar 5.0 Software, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnastar+primer+select+program/primer+select+program+dnastar+5+0+software/pm32109535-59-11-13
    Average 90 stars, based on 1 article reviews
    primer select program dnastar 5.0 software - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    primer select of dnastar laser gene program  (DNASTAR)
    90
    DNASTAR primer select of dnastar laser gene program
    Primer Select Of Dnastar Laser Gene Program, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnastar+primer+select+program/primerselect+dnastar/10__2478_slash_s11756___019___00384___y-56-3-6
    Average 90 stars, based on 1 article reviews
    primer select of dnastar laser gene program - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    primer select program of dnastar lasergene 12 software  (DNASTAR)
    90
    DNASTAR primer select program of dnastar lasergene 12 software
    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR <t>Lasergene</t> <t>12</t> software
    Primer Select Program Of Dnastar Lasergene 12 Software, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnastar+primer+select+program/Lasergene/pmc06508819-88-14-14
    Average 90 stars, based on 1 article reviews
    primer select program of dnastar lasergene 12 software - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    computer program dnastar primer select tool version 7 1  (DNASTAR)
    96
    DNASTAR computer program dnastar primer select tool version 7 1
    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR <t>Lasergene</t> <t>12</t> software
    Computer Program Dnastar Primer Select Tool Version 7 1, supplied by DNASTAR, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnastar+primer+select+program/PrimerSelect/pm23333856-189-9-11
    Average 96 stars, based on 1 article reviews
    computer program dnastar primer select tool version 7 1 - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    dnastar primer select program  (DNASTAR)
    96
    DNASTAR dnastar primer select program
    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR <t>Lasergene</t> <t>12</t> software
    Dnastar Primer Select Program, supplied by DNASTAR, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnastar+primer+select+program/PrimerSelect/10__1128_slash_aem__03250___12-46-16-16
    Average 96 stars, based on 1 article reviews
    dnastar primer select program - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    primer select module in the dnastar computer program  (DNASTAR)
    90
    DNASTAR primer select module in the dnastar computer program
    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR <t>Lasergene</t> <t>12</t> software
    Primer Select Module In The Dnastar Computer Program, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnastar+primer+select+program/primerselect+dnastar/pmc03492786-97-13-13
    Average 90 stars, based on 1 article reviews
    primer select module in the dnastar computer program - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    primer select program of dnastar lasergene 8  (DNASTAR)
    90
    DNASTAR primer select program of dnastar lasergene 8
    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR <t>Lasergene</t> <t>12</t> software
    Primer Select Program Of Dnastar Lasergene 8, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnastar+primer+select+program/primerselect+dnastar/pm20340040-88-10-10
    Average 90 stars, based on 1 article reviews
    primer select program of dnastar lasergene 8 - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    primer select dnastar program  (DNASTAR)
    90
    DNASTAR primer select dnastar program
    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR <t>Lasergene</t> <t>12</t> software
    Primer Select Dnastar Program, supplied by DNASTAR, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnastar+primer+select+program/primerselect+dnastar/us07622272-157-9-11
    Average 90 stars, based on 1 article reviews
    primer select dnastar program - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR Lasergene 12 software

    Journal: Plant Direct

    Article Title: Expression of FLOWERING LOCUS C and a frameshift mutation of this gene on chromosome 20 differentiate a summer and winter annual biotype of Camelina sativa

    doi: 10.1002/pld3.60

    Figure Lengend Snippet: Alignment of FLC chromosomes 8 (Ch08), 13 (Ch13), and 20 (Ch20) sequence obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Coding sequence (CDS) was obtained from Trinity‐assembled RNAseq reads (CO46 and Joelle) or from NCBI (DH55), and consensus sequence (Cons) was obtained from sequencing of PCR‐amplified cDNA. Sequence alignments were developed using the Megalign Pro application in DNASTAR Lasergene 12 software

    Article Snippet: Primers (Supporting Information Table ) were designed using the Primer Select program of DNASTAR Lasergene 12 software (DNASTAR, Inc., Madison, WI, USA) to specifically amplify cDNA based on the assembled camelina RNAseq and WGS of CO46 and Joelle.

    Techniques: Sequencing, Amplification, Software

    Pictograph of assembled whole genome sequence (WGS) and Trinity‐assembled RNAseq data (CDS) for FLC located on chromosomes 8 (Csa08), 13 (Csa13), and 20 (Csa20) obtained from the summer (CO46) or winter (Joelle) annual genotypes of Camelina sativa . Sequence alignments were developed using the Megalign Pro application in DNASTAR Lasergene 12 software. The full sequences corresponding to the pictograph can be viewed in Supporting Information Figure . The seven exons of FLC are outlined at the top of figure and lines connect the corresponding location of the MADS‐box (M), Intervening (I), keratin‐like (K), and C‐terminal (C) domains. Primer pairs used to amplify FLC for resequencing (UF2, UR2, DN47065R1, and DN24968F1) are included below the pictograph

    Journal: Plant Direct

    Article Title: Expression of FLOWERING LOCUS C and a frameshift mutation of this gene on chromosome 20 differentiate a summer and winter annual biotype of Camelina sativa

    doi: 10.1002/pld3.60

    Figure Lengend Snippet: Pictograph of assembled whole genome sequence (WGS) and Trinity‐assembled RNAseq data (CDS) for FLC located on chromosomes 8 (Csa08), 13 (Csa13), and 20 (Csa20) obtained from the summer (CO46) or winter (Joelle) annual genotypes of Camelina sativa . Sequence alignments were developed using the Megalign Pro application in DNASTAR Lasergene 12 software. The full sequences corresponding to the pictograph can be viewed in Supporting Information Figure . The seven exons of FLC are outlined at the top of figure and lines connect the corresponding location of the MADS‐box (M), Intervening (I), keratin‐like (K), and C‐terminal (C) domains. Primer pairs used to amplify FLC for resequencing (UF2, UR2, DN47065R1, and DN24968F1) are included below the pictograph

    Article Snippet: Primers (Supporting Information Table ) were designed using the Primer Select program of DNASTAR Lasergene 12 software (DNASTAR, Inc., Madison, WI, USA) to specifically amplify cDNA based on the assembled camelina RNAseq and WGS of CO46 and Joelle.

    Techniques: Sequencing, Software

    Alignment of amino acid sequence for FLC obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Sequences specific to chromosomes 8 (Ch8), 13 (Ch13), and 20 (Ch20) from the summer annual DH55 were obtained from NCBI, whereas sequence for the summer and winter annual genotypes was generated from sequence of PCR‐amplified cDNA clones. Alignments were made using the Megalign application in DNASTAR Lasergene 12 software

    Journal: Plant Direct

    Article Title: Expression of FLOWERING LOCUS C and a frameshift mutation of this gene on chromosome 20 differentiate a summer and winter annual biotype of Camelina sativa

    doi: 10.1002/pld3.60

    Figure Lengend Snippet: Alignment of amino acid sequence for FLC obtained from summer (CO46 and DH55) and winter (Joelle) annual genotypes of Camelina sativa . Sequences specific to chromosomes 8 (Ch8), 13 (Ch13), and 20 (Ch20) from the summer annual DH55 were obtained from NCBI, whereas sequence for the summer and winter annual genotypes was generated from sequence of PCR‐amplified cDNA clones. Alignments were made using the Megalign application in DNASTAR Lasergene 12 software

    Article Snippet: Primers (Supporting Information Table ) were designed using the Primer Select program of DNASTAR Lasergene 12 software (DNASTAR, Inc., Madison, WI, USA) to specifically amplify cDNA based on the assembled camelina RNAseq and WGS of CO46 and Joelle.

    Techniques: Sequencing, Generated, Amplification, Clone Assay, Software